XcmI-containing vector for direct cloning of PCR products.

Many different strategies are used for cloning polymerase chain reaction (PCR) products. Some use restriction sites pre-integrated into primers or contained in a generated fragment. Others, such as the one used by Stratagene (La Jolla, CA, USA) in its pCR-Script Direct SK(+) Cloning Kit, are based on a blunt-end ligation. These strategies require the use of additional enzymes to polish the ends of PCR products (3) or to increase the efficiency of a bluntend ligation (1). The most efficient cloning strategy is based on terminal transferase activity of Taq DNA polymerases (2). Use of a single 3′ adenylate extension generated by a Taq DNA polymerase is a highly efficient method of integrating any PCR-generated fragment into a properly prepared vector containing complimentary 3′ thymidine overhangs. Such vectors can be purchased from Promega (Madison, WI, USA) or Invitrogen (San Diego, CA, USA), who use this strategy in their PCR cloning systems, or they can be made by using one of the restriction enzymes that generates a single base protruding 3′ ends. Three such restriction enzymes, HphI, MboII and XcmI, are commercially available, but only XcmI is convenient to use because it does not have the multiple recognition sites that are present in commonly used cloning vectors. Absence of the XcmI restriction sites makes it very simple to convert almost any pBR-based plasmid into a PCR cloning vector, unless you are discouraged from using this method by Mead et al. (4), who gave clear preference to the HphI-based over the XcmI-based vector because of the low efficiency of the latter. However, because the authors did not explain why the same approach worked with one enzyme and did not work with the other, we questioned their conclusion and retested this approach using our own XcmI-based vector. The results of our investigation are reported here. An XcmI-containing plasmid was made by cloning an oligonucleotide 5′ GATCCAAGCTTCCCATGGCGCCATGTCATGAGTGGCTGCA between BamHI and PstI sites of pBluescript II (+) Phagemid (Stratagene). The insert contained two distinct XcmI recognition sites which, after digestion, generated single 3′ thymidine overhangs on both ends of the vector and three additional unique restriction sites, KasI, NcoI and RcaI (Figure 1). The vector was designed to have an undisturbed βgalactosidase reading frame that also would be restored after a blunt-end religation of the plasmid that had lost the protruding 3′ ends. This allowed us to distinguish the clones carrying an insert from any type of blanks. The vector was prepared by cutting the plasmid with XcmI. After digestion the vector was concentrated by ethanol, redissolved in TE buffer (10 mM TrisHCl, 1 mM EDTA, pH 8.0) or water and used for ligation without any additional steps. Ligation was usually done overnight at 6°–8°C in total volume of 10 μL that contained 10 ng of the vector, 5 μL of a PCR, 1 μL of 10× T4 ligase buffer provided with the enzyme and 100–200 U of T4 DNA ligase. On the following day the ligation mixture was used for E. coli transformation. The cells were plated on LB agar supplemented with ampicillin, 5-bromo-4chloro-3-indolyl-β-D-galactopyranoside (X-gal) and isopropyl-β-D-thiogalactopyranoside (IPTG). A white:blue colonies ratio varied from 1:5 to 1:1 and depended most on vector preparation and amount of PCR product used for ligation. The cloning